B15581 CNAG_04407 diagnostic screening primer SO, pairing with B79
TCCGGGAAGAAGTCACAATC
B15582 CNAG_04407 Southern blot probe primer PO
TCGACCAGTTCGTTGACATC
3D AlphaFold-predicted Structure Viewer
WD40 Boundaries: (Domain E-value)
366-398(4.30E-4), 515-553(6.90E-5) 
Very high (pLDDT > 90)
High (90 > pLDDT > 70)
Low (70 > pLDDT > 50)
Very low (pLDDT < 50)
NCBI Protein ID: XP_012051792.1 UniProt ID: J9VS98 Organism: Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487) Gene Symbol: CNAG_04407 Annotation: dynein intermediate chain, cytosolic Length: 711 AA Download CIFView on AlphaFold DB
WD40 Domain
: WD40 domains are mapped using HMMsearch (**Parameter used: Sequence-level E-value < 1, Domain-level E-value < 1E-2)
against Pfam PF00400.38 (canonical WD40). If no PF00400.38 hit is found, subclass Pfam domains (e.g., WD40_CDC20-Fz,
WD40_WDHD1_1st, WDR55) are displayed. Each domain-level E-value indicates the statistical significance.
Model Confidence
: The predicted local distance difference test (pLDDT) is a per-residue measure of local confidence. It is scaled
from 0 to 100, with higher scores indicating higher confidence and usually a more accurate prediction.